Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCCAGGTGCGAAAGGTGCAAGGCA[C/T]CAACTTGGGCAAAATATATGCCATG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613368 MIM: 609849 MIM: 601577 MIM: 608939 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CARNS1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CARNS1 - carnosine synthase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CORO1B - coronin 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTPRCAP - protein tyrosine phosphatase, receptor type C associated protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS6KB2 - ribosomal protein S6 kinase B2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003952.2 | 299 | Missense Mutation | ACC,ATC | T,I 90 | NP_003943.2 | |
XM_005274164.1 | 299 | UTR 5 | XP_005274221.1 | |||
XM_005274165.4 | 299 | UTR 5 | XP_005274222.1 | |||
XM_006718655.3 | 299 | UTR 5 | XP_006718718.1 | |||
XM_006718656.3 | 299 | UTR 5 | XP_006718719.1 | |||
XM_006718657.1 | 299 | UTR 5 | XP_006718720.1 | |||
XM_017018108.1 | 299 | UTR 5 | XP_016873597.1 |