Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTGGAGCTGGCCCAGAAGTTGGC[C/T]GAGTCAGAAGGCCTGAGCTTGCTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601442 MIM: 604633 MIM: 606591 | ||||||||||||||||||||
Literature Links: |
CFL1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CFL1 - cofilin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EFEMP2 - EGF containing fibulin like extracellular matrix protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MUS81 - MUS81 structure-specific endonuclease subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_025128.4 | 819 | Silent Mutation | GCC,GCT | A,A 217 | NP_079404.3 | |
XM_005274307.2 | 819 | Silent Mutation | GCC,GCT | A,A 217 | XP_005274364.1 | |
XM_011545269.1 | 819 | Silent Mutation | GCC,GCT | A,A 217 | XP_011543571.1 | |
XM_011545270.1 | 819 | Silent Mutation | GCC,GCT | A,A 217 | XP_011543572.1 |
SNX32 - sorting nexin 32 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |