Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTCGATCTCTTGAAGCATGTACAC[C/G]ATGTATGGGCCTGTGGTGGGGGTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605517 MIM: 606259 MIM: 605965 | ||||||||||||||||||||
Literature Links: |
B4GAT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
B4GAT1 - beta-1,4-glucuronyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BRMS1 - breast cancer metastasis suppressor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024957.1 | 786 | Silent Mutation | ATC,ATG | I,M 213 | NP_001020128.1 | |
NM_015399.3 | 786 | Silent Mutation | ATC,ATG | I,M 213 | NP_056214.1 |
LOC102724064 - uncharacterized LOC102724064 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RIN1 - Ras and Rab interactor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |