Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATCCGGTCATACATCCACATCAGG[C/T]CTGGCCAGCTGGATGTTCTTAAAGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601074 MIM: 603846 MIM: 609538 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CELF1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CELF1 - CUGBP, Elav-like family member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KBTBD4 - kelch repeat and BTB domain containing 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318716.1 | 710 | Intron | NP_001305645.1 | |||
NM_001318717.1 | 710 | Intron | NP_001305646.1 | |||
NM_001318718.1 | 710 | Intron | NP_001305647.1 | |||
NM_001318719.1 | 710 | Intron | NP_001305648.1 | |||
NM_001318720.1 | 710 | Intron | NP_001305649.1 | |||
NM_001318721.1 | 710 | Intron | NP_001305650.1 | |||
NM_001318722.1 | 710 | Intron | NP_001305651.1 | |||
NM_001318723.1 | 710 | Intron | NP_001305652.1 | |||
NM_001318724.1 | 710 | Intron | NP_001305653.1 | |||
NM_001318725.1 | 710 | Intron | NP_001305654.1 | |||
NM_016506.6 | 710 | Intron | NP_057590.3 | |||
NM_018095.5 | 710 | Intron | NP_060565.4 | |||
XM_017018009.1 | 710 | Intron | XP_016873498.1 |
NDUFS3 - NADH:ubiquinone oxidoreductase core subunit S3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTPMT1 - protein tyrosine phosphatase, mitochondrial 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001143984.1 | 710 | Missense Mutation | GCC,GTC | A,V 145 | NP_001137456.1 | |
NM_175732.2 | 710 | Missense Mutation | CCT,TCT | P,S 173 | NP_783859.1 |