Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGCAGGAGGCCCTGCGGGACAGCT[C/T]GGTGAGCAGCCTGAGGCCTCGCCCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 118491 MIM: 602141 MIM: 604592 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHKA PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHKA - choline kinase alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6753 - microRNA 6753 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFS8 - NADH:ubiquinone oxidoreductase core subunit S8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCIRG1 - T-cell immune regulator 1, ATPase H+ transporting V0 subunit a3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006019.3 | 1143 | Missense Mutation | TCG,TTG | S,L 340 | NP_006010.2 | |
NM_006053.3 | 1143 | Missense Mutation | TCG,TTG | S,L 124 | NP_006044.1 | |
XM_005273709.3 | 1143 | Missense Mutation | TCG,TTG | S,L 340 | XP_005273766.1 | |
XM_011544726.2 | 1143 | Missense Mutation | TCG,TTG | S,L 340 | XP_011543028.1 | |
XM_017017089.1 | 1143 | Missense Mutation | TCG,TTG | S,L 340 | XP_016872578.1 | |
XM_017017090.1 | 1143 | Missense Mutation | TCG,TTG | S,L 42 | XP_016872579.1 |