Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCATCTTCCCAGTCATGTTTCCTTC[A/G]TATTCTTCTGCCCACATACTCTCAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 168730 MIM: 613962 MIM: 609627 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PRH1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PRH1 - proline rich protein HaeIII subfamily 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291314.1 | 526 | Intron | NP_001278243.1 | |||
NM_001291315.1 | 526 | Intron | NP_001278244.1 |
PRH1-PRR4 - PRH1-PRR4 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRH1-TAS2R14 - PRH1-TAS2R14 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001316893.1 | 526 | Intron | NP_001303822.1 |
TAS2R20 - taste 2 receptor member 20 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAS2R50 - taste 2 receptor member 50 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_176890.2 | 526 | Silent Mutation | TAC,TAT | Y,Y 158 | NP_795371.2 |