Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCCACAGAGGAGAAGCGCATCTAC[C/T]GGGTGCCTGTTTTCACAGCGCCCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605453 MIM: 607668 MIM: 608920 | ||||||||||||||||||||
Literature Links: |
ABCB9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABCB9 - ATP binding cassette subfamily B member 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ARL6IP4 - ADP ribosylation factor like GTPase 6 interacting protein 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OGFOD2 - 2-oxoglutarate and iron dependent oxygenase domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304833.1 | 708 | Missense Mutation | CGG,TGG | R,W 141 | NP_001291762.1 | |
NM_001304834.1 | 708 | UTR 5 | NP_001291763.1 | |||
NM_001304835.1 | 708 | UTR 5 | NP_001291764.1 | |||
NM_001304836.1 | 708 | UTR 5 | NP_001291765.1 | |||
NM_001304837.1 | 708 | UTR 5 | NP_001291766.1 | |||
NM_001304838.1 | 708 | UTR 5 | NP_001291767.1 | |||
NM_024623.2 | 708 | Missense Mutation | CGG,TGG | R,W 81 | NP_078899.1 |
PITPNM2 - phosphatidylinositol transfer protein membrane associated 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |