Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AACAGATTAACAGCAGAAAACATAT[G/T]AGGCTCAGAGTAAAGGGTATGAGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 168730 MIM: 613961 MIM: 612669 | ||||||||||||||||||||
Literature Links: |
PRH1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PRH1 - proline rich protein HaeIII subfamily 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291314.1 | 625 | Intron | NP_001278243.1 | |||
NM_001291315.1 | 625 | Intron | NP_001278244.1 |
PRH1-PRR4 - PRH1-PRR4 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRH1-TAS2R14 - PRH1-TAS2R14 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001316893.1 | 625 | Intron | NP_001303822.1 |
TAS2R19 - taste 2 receptor member 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_176888.2 | 625 | Silent Mutation | CTA,CTC | L,L 192 | NP_795369.1 |
TAS2R31 - taste 2 receptor member 31 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |