Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCGAGATCCCTGGGATCTGCACCCA[A/T]CTCCAGCCATCTGCATCTGGCCCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615488 MIM: 615487 | ||||||||||||||||||||
Literature Links: |
KANSL2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KANSL2 - KAT8 regulatory NSL complex subunit 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017822.3 | 1445 | Missense Mutation | GAT,GTT | D,V 457 | NP_060292.3 |
MIR1291 - microRNA 1291 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA2A - small nucleolar RNA, H/ACA box 2A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA2C - small nucleolar RNA, H/ACA box 2C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |