Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCCATGCTGACTGCAGTGGGAAG[A/G]AGGTGACCTGTGAGATCTCCCGCTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 186711 MIM: 607081 MIM: 185880 | ||||||||||||||||||||
Literature Links: |
CD27 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CD27 - CD27 molecule | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CD27-AS1 - CD27 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAPBPL - TAP binding protein like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018009.4 | 741 | Missense Mutation | AAG,GAG | K,E 119 | NP_060479.3 | |
XM_005253700.3 | 741 | Missense Mutation | AAG,GAG | K,E 119 | XP_005253757.1 | |
XM_017019545.1 | 741 | UTR 5 | XP_016875034.1 | |||
XM_017019546.1 | 741 | UTR 5 | XP_016875035.1 |
VAMP1 - vesicle associated membrane protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |