Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAAGGCTGGCGGTTGCCGGAGTAC[A/C]CAGTGACCCAGGAGTCTGGGCCAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606371 MIM: 600447 MIM: 604643 MIM: 605053 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATF7 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATF7 - activating transcription factor 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100652999 - uncharacterized LOC100652999 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAP3K12 - mitogen-activated protein kinase kinase kinase 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NPFF - neuropeptide FF-amide peptide precursor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TARBP2 - TARBP2, RISC loading complex RNA binding subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004178.4 | 642 | Missense Mutation | ACA,CCA | T,P 158 | NP_004169.3 | |
NM_134323.1 | 642 | Missense Mutation | ACA,CCA | T,P 179 | NP_599150.1 | |
NM_134324.2 | 642 | Missense Mutation | ACA,CCA | T,P 158 | NP_599151.2 | |
XM_005269114.1 | 642 | Missense Mutation | ACA,CCA | T,P 158 | XP_005269171.1 | |
XM_005269115.2 | 642 | Missense Mutation | ACA,CCA | T,P 158 | XP_005269172.1 | |
XM_005269117.1 | 642 | Missense Mutation | ACA,CCA | T,P 179 | XP_005269174.1 | |
XM_005269120.4 | 642 | Missense Mutation | ACA,CCA | T,P 35 | XP_005269177.1 | |
XM_005269122.3 | 642 | Missense Mutation | ACA,CCA | T,P 35 | XP_005269179.1 | |
XM_006719581.1 | 642 | Missense Mutation | ACA,CCA | T,P 80 | XP_006719644.1 | |
XM_011538712.2 | 642 | Missense Mutation | ACA,CCA | T,P 35 | XP_011537014.1 | |
XM_017019910.1 | 642 | Missense Mutation | ACA,CCA | T,P 158 | XP_016875399.1 | |
XM_017019911.1 | 642 | Missense Mutation | ACA,CCA | T,P 35 | XP_016875400.1 |