Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCAAGGCCAGCACGGCCCCTGGGG[C/T]GGAGGGTGAGGACCACAGGCATCGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605453 MIM: 607668 MIM: 608920 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ABCB9 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ABCB9 - ATP binding cassette subfamily B member 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ARL6IP4 - ADP ribosylation factor like GTPase 6 interacting protein 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002251.2 | 852 | Missense Mutation | GCG,GTG | A,V 236 | NP_001002251.2 | |
NM_001002252.2 | 852 | Intron | NP_001002252.2 | |||
NM_001278378.1 | 852 | Missense Mutation | GCG,GTG | A,V 236 | NP_001265307.1 | |
NM_001278379.1 | 852 | Intron | NP_001265308.1 | |||
NM_001278380.1 | 852 | Intron | NP_001265309.1 | |||
NM_016638.3 | 852 | Intron | NP_057722.3 | |||
NM_018694.3 | 852 | Missense Mutation | GCG,GTG | A,V 236 | NP_061164.3 |
OGFOD2 - 2-oxoglutarate and iron dependent oxygenase domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PITPNM2 - phosphatidylinositol transfer protein membrane associated 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |