Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGTCAAGGGTTCAAAGTATGGTA[C/T]TTTACTCACATGGAACATTTCAGTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604793 MIM: 604794 MIM: 604795 | ||||||||||||||||||||
Literature Links: |
TAS2R7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
TAS2R7 - taste 2 receptor member 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAS2R8 - taste 2 receptor member 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_023918.1 | 529 | Missense Mutation | ATA,GTA | I,V 177 | NP_076407.1 |
TAS2R9 - taste 2 receptor member 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |