Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGTGAAGACGATTTACTTCTTCC[C/T]GCCTTTTTGGGTTCTCTGGGTAAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
C12orf60 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C12orf60 - chromosome 12 open reading frame 60 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_175874.3 | 2782 | Intron | NP_787070.2 | |||
XM_005253322.4 | 2782 | Intron | XP_005253379.1 | |||
XM_011520568.2 | 2782 | Intron | XP_011518870.1 | |||
XM_011520569.2 | 2782 | Intron | XP_011518871.1 | |||
XM_017018871.1 | 2782 | Intron | XP_016874360.1 | |||
XM_017018872.1 | 2782 | Intron | XP_016874361.1 | |||
XM_017018873.1 | 2782 | Intron | XP_016874362.1 | |||
XM_017018874.1 | 2782 | Intron | XP_016874363.1 |
SMCO3 - single-pass membrane protein with coiled-coil domains 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001013698.2 | 2782 | Missense Mutation | CAG,CGG | Q,R 15 | NP_001013720.2 | |
XM_017019312.1 | 2782 | Missense Mutation | CAG,CGG | Q,R 15 | XP_016874801.1 |
WBP11 - WW domain binding protein 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |