Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTCTGTTCAGCAGCCCGTGACAG[A/G]GGAGAGTTTAAAAATCCGCCACACC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614285 | ||||||||||||||||||||
Literature Links: |
C1QTNF9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C1QTNF9 - C1q and tumor necrosis factor related protein 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001303137.1 | Intron | NP_001290066.1 | ||||
NM_001303138.1 | Intron | NP_001290067.1 | ||||
NM_178540.4 | Intron | NP_848635.2 |
LINC00566 - long intergenic non-protein coding RNA 566 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NUS1P3 - NUS1 dehydrodolichyl diphosphate synthase subunit pseudogene 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |