Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGAGGCCTTCGGGCGGCCGTTGCC[A/G]CGCGGGGCCCGAGCGGGAGGGAGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603461 MIM: 605530 | ||||||||||||||||||||
Literature Links: |
CDC16 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDC16 - cell division cycle 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4502 - microRNA 4502 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UPF3A - UPF3 regulator of nonsense transcripts homolog A (yeast) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_023011.3 | 105 | Missense Mutation | ACG,GCG | T,A 17 | NP_075387.1 | |
NM_080687.2 | 105 | Missense Mutation | ACG,GCG | T,A 17 | NP_542418.1 | |
XM_005266202.4 | 105 | Intron | XP_005266259.1 | |||
XM_006719991.3 | 105 | Intron | XP_006720054.1 | |||
XM_011534844.1 | 105 | Intron | XP_011533146.1 | |||
XM_011534845.2 | 105 | Intron | XP_011533147.1 | |||
XM_011534846.1 | 105 | Missense Mutation | ACG,GCG | T,A 17 | XP_011533148.1 | |
XM_011534847.2 | 105 | Intron | XP_011533149.1 | |||
XM_011534848.2 | 105 | Intron | XP_011533150.1 | |||
XM_017020709.1 | 105 | Intron | XP_016876198.1 | |||
XM_017020710.1 | 105 | Intron | XP_016876199.1 | |||
XM_017020711.1 | 105 | Intron | XP_016876200.1 | |||
XM_017020712.1 | 105 | Missense Mutation | ACG,GCG | T,A 17 | XP_016876201.1 |