Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCGCCAACTTCGTCCTCCGGTTGC[G/T]GGGGCGGTGCGGGCAAACCTCGCGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603461 MIM: 605530 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CDC16 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CDC16 - cell division cycle 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4502 - microRNA 4502 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UPF3A - UPF3 regulator of nonsense transcripts homolog A (yeast) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_023011.3 | 213 | Missense Mutation | GGG,TGG | G,W 53 | NP_075387.1 | |
NM_080687.2 | 213 | Missense Mutation | GGG,TGG | G,W 53 | NP_542418.1 | |
XM_005266202.4 | 213 | Intron | XP_005266259.1 | |||
XM_006719991.3 | 213 | Intron | XP_006720054.1 | |||
XM_011534844.1 | 213 | Intron | XP_011533146.1 | |||
XM_011534845.2 | 213 | Intron | XP_011533147.1 | |||
XM_011534846.1 | 213 | Missense Mutation | GGG,TGG | G,W 53 | XP_011533148.1 | |
XM_011534847.2 | 213 | Intron | XP_011533149.1 | |||
XM_011534848.2 | 213 | Intron | XP_011533150.1 | |||
XM_017020709.1 | 213 | Intron | XP_016876198.1 | |||
XM_017020710.1 | 213 | Intron | XP_016876199.1 | |||
XM_017020711.1 | 213 | Intron | XP_016876200.1 | |||
XM_017020712.1 | 213 | Missense Mutation | GGG,TGG | G,W 53 | XP_016876201.1 |