Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCTGGGAGACAGCTCTCTTTCTTC[C/T]CCTAATCCTGCAAGTGCTCATTTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602161 MIM: 612487 | ||||||||||||||||||||
Literature Links: |
EMC9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EMC9 - ER membrane protein complex subunit 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR7703 - microRNA 7703 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSME2 - proteasome activator subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF31 - ring finger protein 31 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001310332.1 | 787 | Silent Mutation | TCC,TCT | S,S 143 | NP_001297261.1 | |
NM_017999.4 | 787 | Silent Mutation | TCC,TCT | S,S 294 | NP_060469.4 |