Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTGGGGCAAGGGTACTCACGGCAA[A/G]GCCAGTGGCAGTGACTGCCAAAAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 107748 MIM: 610107 MIM: 609865 | ||||||||||||||||||||
Literature Links: |
APEX1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
APEX1 - apurinic/apyrimidinic endodeoxyribonuclease 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OSGEP - O-sialoglycoprotein endopeptidase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM55B - transmembrane protein 55B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001100814.2 | 993 | Missense Mutation | CTT,TTT | L,F 236 | NP_001094284.1 | |
NM_144568.3 | 993 | Missense Mutation | CTT,TTT | L,F 229 | NP_653169.2 |