Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCTCAATTACGTGCTGGTACGAGT[G/T]CAACCCCCGCAGCCCGGCCTGCCGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 147574 MIM: 608193 | ||||||||||||||||||||
Literature Links: |
IPO4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IPO4 - importin 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IRF9 - interferon regulatory factor 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
REC8 - REC8 meiotic recombination protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001048205.1 | 859 | Silent Mutation | GTG,GTT | V,V 53 | NP_001041670.1 | |
NM_005132.2 | 859 | Silent Mutation | GTG,GTT | V,V 53 | NP_005123.2 | |
XM_011537421.1 | 859 | Silent Mutation | GTG,GTT | V,V 53 | XP_011535723.1 | |
XM_017021841.1 | 859 | UTR 5 | XP_016877330.1 |