Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGGGACAGGAGACTCTCTTCATCA[C/T]AGAGCTTTGAGCGGGACTGGTCAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610528 MIM: 605012 | ||||||||||||||||||||
Literature Links: |
CHD8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHD8 - chromodomain helicase DNA binding protein 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001170629.1 | 5654 | Missense Mutation | TAT,TGT | Y,C 2115 | NP_001164100.1 | |
NM_020920.3 | 5654 | Missense Mutation | TAT,TGT | Y,C 1836 | NP_065971.2 |
SNORD8 - small nucleolar RNA, C/D box 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD9 - small nucleolar RNA, C/D box 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SUPT16H - SPT16 homolog, facilitates chromatin remodeling subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |