Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTGATGTCCTTGAATGGATCCAGC[A/G]CTACGGGGCCTGCTCTGAGCCCCTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610051 MIM: 610711 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHMP4A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHMP4A - charged multivesicular body protein 4A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MDP1 - magnesium dependent phosphatase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEDD8-MDP1 - NEDD8-MDP1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSSK4 - testis specific serine kinase 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001184739.1 | 551 | Missense Mutation | CAC,CGC | H,R 116 | NP_001171668.1 | |
NM_001308067.1 | 551 | Missense Mutation | CAC,CGC | H,R 40 | NP_001294996.1 | |
NM_174944.3 | 551 | Missense Mutation | CAC,CGC | H,R 116 | NP_777604.2 | |
XM_011536663.2 | 551 | Missense Mutation | CAC,CGC | H,R 40 | XP_011534965.1 | |
XM_017021226.1 | 551 | Missense Mutation | CAC,CGC | H,R 116 | XP_016876715.1 |