Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACACTTCTTACAGAAGGTTCTTCG[C/G]GTTTTAGGTACGTTGACCATCTTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612517 MIM: 609193 MIM: 602616 MIM: 180469 | ||||||||||||||||||||
Literature Links: |
DNAAF2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DNAAF2 - dynein axonemal assembly factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRR1 - leucine rich repeat protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MGAT2 - mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL36AL - ribosomal protein L36a like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001.4 | Intron | NP_000992.1 |