Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACCTGGGAATGCAGCAGCTGCACC[T/C]GCTCACTAGTCTCAATCAGCTCCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616096 MIM: 613613 MIM: 160710 MIM: 160760 | ||||||||||||||||||||
Literature Links: |
MHRT PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MHRT - myosin heavy chain-associated RNA transcript | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR208B - microRNA 208b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYH6 - myosin heavy chain 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYH7 - myosin, heavy chain 7, cardiac muscle, beta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000257.3 | 5201 | Missense Mutation | CAG,CGG | Q,R 1712 | NP_000248.2 | |
XM_017021340.1 | 5201 | Missense Mutation | CAG,CGG | Q,R 1712 | XP_016876829.1 |