Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATGGCATTGTAGTGACCTCTGGGC[A/G]GCCACGCTGGGGCAGGAAGTGGGTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609011 | ||||||||||||||||||||
Literature Links: |
ANGEL1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANGEL1 - angel homolog 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015305.3 | 1872 | Missense Mutation | CGC,TGC | R,C 587 | NP_056120.2 | |
XM_017021115.1 | 1872 | UTR 3 | XP_016876604.1 |
LOC100506603 - uncharacterized LOC100506603 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VASH1 - vasohibin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |