Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGACACTTAGAACAAACTTATTCA[C/T]CTGTTCCTCCTCGGGCCCGCTGTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616309 | ||||||||||||||||||||
Literature Links: |
FRMD5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FRMD5 - FERM domain containing 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286490.1 | 1720 | Intron | NP_001273419.1 | |||
NM_001286491.1 | 1720 | Missense Mutation | ATG,GTG | M,V 260 | NP_001273420.1 | |
NM_001322949.1 | 1720 | Intron | NP_001309878.1 | |||
NM_001322950.1 | 1720 | Intron | NP_001309879.1 | |||
NM_001322951.1 | 1720 | Intron | NP_001309880.1 | |||
NM_032892.4 | 1720 | Missense Mutation | ATG,GTG | M,V 494 | NP_116281.2 | |
XM_005254730.3 | 1720 | Intron | XP_005254787.1 |
PIN4P1 - peptidylprolyl cis/trans isomerase, NIMA-interacting 4 pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR76 - WD repeat domain 76 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |