Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGAAAACTAGAGGTGTTCCCCTAT[C/T]GGAAGCTGGTAATGTGAAAAGCCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604799 MIM: 612393 | ||||||||||||||||||||
Literature Links: |
HOMER2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HOMER2 - homer scaffolding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WHAMM - WAS protein homolog associated with actin, golgi membranes and microtubules | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080435.2 | 1258 | Missense Mutation | TCG,TTG | S,L 599 | NP_001073904.1 | |
XM_005272421.4 | 1258 | Missense Mutation | TCG,TTG | S,L 386 | XP_005272478.1 | |
XM_005272422.3 | 1258 | Missense Mutation | TCG,TTG | S,L 369 | XP_005272479.1 | |
XM_005272423.4 | 1258 | Missense Mutation | TCG,TTG | S,L 369 | XP_005272480.1 | |
XM_011521232.2 | 1258 | Missense Mutation | TCG,TTG | S,L 326 | XP_011519534.1 | |
XM_017021923.1 | 1258 | Intron | XP_016877412.1 |