Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCTCACATTGGGGCGGGATGTGG[C/G]AGCGGCTGAACTGCGCAGCAGAGGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 180479 MIM: 605979 MIM: 609984 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR4512 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR4512 - microRNA 4512 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL4 - ribosomal protein L4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000968.3 | 263 | Intron | NP_000959.2 |
SNAPC5 - small nuclear RNA activating complex polypeptide 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD16 - small nucleolar RNA, C/D box 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD18A - small nucleolar RNA, C/D box 18A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD18B - small nucleolar RNA, C/D box 18B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD18C - small nucleolar RNA, C/D box 18C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZWILCH - zwilch kinetochore protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001287821.1 | 263 | UTR 5 | NP_001274750.1 | |||
NM_001287822.1 | 263 | UTR 5 | NP_001274751.1 | |||
NM_001287823.1 | 263 | UTR 5 | NP_001274752.1 | |||
NM_017975.4 | 263 | Missense Mutation | CAG,GAG | Q,E 3 | NP_060445.3 |