Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCACACCAACCCATGCTGCTGGC[A/G]TCTAAGTGTTTGGGAAGCAACAAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 176872 MIM: 180479 MIM: 605979 | ||||||||||||||||||||
Literature Links: |
MAP2K1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MAP2K1 - mitogen-activated protein kinase kinase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002755.3 | 1525 | Intron | NP_002746.1 | |||
XM_011521783.2 | 1525 | Intron | XP_011520085.1 | |||
XM_017022411.1 | 1525 | Missense Mutation | ATC,GTC | I,V 367 | XP_016877900.1 | |
XM_017022412.1 | 1525 | Missense Mutation | ATC,GTC | I,V 345 | XP_016877901.1 | |
XM_017022413.1 | 1525 | Missense Mutation | ATC,GTC | I,V 217 | XP_016877902.1 |
MIR4512 - microRNA 4512 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL4 - ribosomal protein L4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNAPC5 - small nuclear RNA activating complex polypeptide 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |