Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTACCACTCTATGAGCTCGATGGCA[C/T]GAGCAGCGTTCTCTGAGGATGGGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606881 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FHOD1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FHOD1 - formin homology 2 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318202.1 | 449 | Intron | NP_001305131.1 | |||
NM_013241.2 | 449 | Intron | NP_037373.2 | |||
XM_006721180.1 | 449 | Intron | XP_006721243.1 | |||
XM_011523043.2 | 449 | Intron | XP_011521345.1 | |||
XM_011523044.1 | 449 | Intron | XP_011521346.1 | |||
XM_011523045.2 | 449 | Intron | XP_011521347.1 |
LOC105369155 - uncharacterized LOC105369155 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC29 - leucine rich repeat containing 29 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM208 - transmembrane protein 208 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318217.1 | 449 | Nonsense Mutation | CGA,TGA | R,* 6 | NP_001305146.1 | |
NM_014187.3 | 449 | Nonsense Mutation | CGA,TGA | R,* 76 | NP_054906.2 |