Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCGTAGCCACGAAGTGATCCGGGC[A/G]CTGACGGCCCGTGGCATCTGCGTGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 108745 MIM: 611113 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
AMDHD2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
AMDHD2 - amidohydrolase domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145815.1 | 694 | Silent Mutation | GCA,GCG | A,A 199 | NP_001139287.1 | |
NM_015944.3 | 694 | Silent Mutation | GCA,GCG | A,A 199 | NP_057028.2 | |
XM_017023262.1 | 694 | Silent Mutation | GCA,GCG | A,A 199 | XP_016878751.1 | |
XM_017023263.1 | 694 | Silent Mutation | GCA,GCG | A,A 199 | XP_016878752.1 | |
XM_017023264.1 | 694 | Silent Mutation | GCA,GCG | A,A 199 | XP_016878753.1 | |
XM_017023265.1 | 694 | Silent Mutation | GCA,GCG | A,A 199 | XP_016878754.1 | |
XM_017023266.1 | 694 | Silent Mutation | GCA,GCG | A,A 36 | XP_016878755.1 | |
XM_017023267.1 | 694 | UTR 5 | XP_016878756.1 |
ATP6V0C - ATPase H+ transporting V0 subunit c | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CEMP1 - cementum protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3178 - microRNA 3178 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |