Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGGGGTTGTGGGCGCCCCCTGGCT[G/T]CTCCTTCTCTGCGGCCAGAGGCTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607985 | ||||||||||||||||||||
Literature Links: |
NAGPA PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NAGPA - N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016256.3 | 1456 | Missense Mutation | AAG,CAG | K,Q 505 | NP_057340.2 | |
XM_011522517.2 | 1456 | Missense Mutation | AAG,CAG | K,Q 477 | XP_011520819.1 |
NAGPA-AS1 - NAGPA antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEC14L5 - SEC14 like lipid binding 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |