Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTTCCAGGACCCGTGCATCTCTTC[C/T]GACTCTCGGGCAAGTGCTTCAGCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607838 | ||||||||||||||||||||
Literature Links: |
GNPTG PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GNPTG - N-acetylglucosamine-1-phosphate transferase gamma subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032520.4 | 279 | Nonsense Mutation | CGA,TGA | R,* 66 | NP_115909.1 | |
XM_017023782.1 | 279 | Nonsense Mutation | CGA,TGA | R,* 82 | XP_016879271.1 | |
XM_017023783.1 | 279 | UTR 5 | XP_016879272.1 |
TSR3 - TSR3, acp transferase ribosome maturation factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UNKL - unkempt family like zinc finger | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |