Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTTGAGCAGGTGTCCTGCTGCTCT[A/G]AAGAGCCCCTGGTGAGTAGGAACAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608021 | ||||||||||||||||||||
Literature Links: |
LOC100287175 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100287175 - uncharacterized LOC100287175 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MCRIP2 - MAPK regulated corepressor interacting protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
METTL26 - methyltransferase like 26 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040160.2 | 537 | Silent Mutation | TTC,TTT | F,F 123 | NP_001035250.1 | |
NM_001040161.2 | 537 | Intron | NP_001035251.1 | |||
NM_001040162.2 | 537 | Missense Mutation | TCA,TTA | S,L 69 | NP_001035252.1 | |
NM_001040165.2 | 537 | Intron | NP_001035255.1 | |||
NM_001288710.1 | 537 | Intron | NP_001275639.1 | |||
NM_032366.4 | 537 | Silent Mutation | TTC,TTT | F,F 123 | NP_115742.3 | |
XM_011522713.2 | 537 | Nonsense Mutation | CAG,TAG | Q,* 155 | XP_011521015.1 | |
XM_011522714.2 | 537 | Nonsense Mutation | CAG,TAG | Q,* 155 | XP_011521016.1 |
RAB40C - RAB40C, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WFIKKN1 - WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |