Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCATGCAGAGGTTCGCGGGGCTGC[C/G]GGAGACCGGCCGCATGGGTAGGTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608482 | ||||||||||||||||||||
Literature Links: |
LOC100128770 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100128770 - uncharacterized LOC100128770 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MMP25 - matrix metallopeptidase 25 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022468.4 | 6 | Missense Mutation | CCG,CGG | P,R 72 | NP_071913.1 | |
XM_011522602.2 | 6 | UTR 5 | XP_011520904.1 | |||
XM_011522604.2 | 6 | Intron | XP_011520906.1 | |||
XM_011522605.2 | 6 | Intron | XP_011520907.1 | |||
XM_017023561.1 | 6 | Missense Mutation | CCG,CGG | P,R 72 | XP_016879050.1 |
MMP25-AS1 - MMP25 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |