Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACACGCAGTCACTTTCCTGATTATT[C/T]TTCACATCCCCTAGAGTGGAGACTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603022 MIM: 612190 MIM: 172280 | ||||||||||||||||||||
Literature Links: |
BRICD5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BRICD5 - BRICHOS domain containing 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182563.3 | 914 | Intron | NP_872369.2 | |||
XM_005255263.4 | 914 | Intron | XP_005255320.1 |
E4F1 - E4F transcription factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MLST8 - MTOR associated protein, LST8 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PGP - phosphoglycolate phosphatase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001042371.2 | 914 | Silent Mutation | AAA,AAG | K,K 290 | NP_001035830.1 |