Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGGCTCGATCGCGAGCCCCAGGC[C/T]GGGCCAGGCTCTGTAGGCAGCGGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612897 MIM: 613620 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC107983970 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LOC107983970 - uncharacterized LOC107983970 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYLPF - myosin light chain, phosphorylatable, fast skeletal muscle | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEPT1 - septin 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_052838.4 | 1083 | Missense Mutation | NP_443070.5 | |||
XM_017022991.1 | 1083 | Missense Mutation | XP_016878480.1 |
TBC1D10B - TBC1 domain family member 10B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF48 - zinc finger protein 48 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001214906.1 | 1083 | Intron | NP_001201835.1 | |||
NM_001214907.1 | 1083 | Intron | NP_001201836.1 | |||
NM_001214909.1 | 1083 | Intron | NP_001201838.1 | |||
NM_001324494.1 | 1083 | Intron | NP_001311423.1 | |||
NM_152652.2 | 1083 | Intron | NP_689865.2 |