Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCGACGGTCGCCGTGGCCCCGGT[C/T]GCGTCTGCCTTGGAGAAGAAGACAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603213 MIM: 600999 MIM: 612033 MIM: 614386 | ||||||||||||||||||||
Literature Links: |
KIF22 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KIF22 - kinesin family member 22 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAZ - MYC associated zinc finger protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001042539.2 | 508 | Silent Mutation | GTC,GTT | V,V 176 | NP_001036004.1 | |
NM_001276275.1 | 508 | Silent Mutation | GTC,GTT | V,V 153 | NP_001263204.1 | |
NM_001276276.1 | 508 | Intron | NP_001263205.1 | |||
NM_002383.3 | 508 | Silent Mutation | GTC,GTT | V,V 176 | NP_002374.2 | |
XM_006721047.3 | 508 | Silent Mutation | GTC,GTT | V,V 153 | XP_006721110.1 | |
XM_006721048.3 | 508 | Silent Mutation | GTC,GTT | V,V 176 | XP_006721111.1 |
PAGR1 - PAXIP1 associated glutamate rich protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRRT2 - proline rich transmembrane protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |