Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAACAATGCAGAAATCATAGAGCAC[A/G]AAGAACAGGATCCAGGCCAGGTAGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610561 MIM: 608547 | ||||||||||||||||||||
Literature Links: |
PRSS53 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PRSS53 - protease, serine 53 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VKORC1 - vitamin K epoxide reductase complex subunit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001311311.1 | 732 | Silent Mutation | TTC,TTT | F,F 154 | NP_001298240.1 | |
NM_024006.5 | 732 | Silent Mutation | TTC,TTT | F,F 126 | NP_076869.1 | |
NM_206824.2 | 732 | Missense Mutation | CGT,TGT | R,C 90 | NP_996560.1 |
ZNF646 - zinc finger protein 646 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |