Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTGGCTGACCGAGATCCACGAGT[A/T]CGCCCAGCACGACGTGGCGCTCATG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605455 MIM: 606692 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
RAB26 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
RAB26 - RAB26, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308053.1 | 667 | Missense Mutation | TAC,TTC | Y,F 99 | NP_001294982.1 | |
NM_014353.4 | 667 | Missense Mutation | TAC,TTC | Y,F 165 | NP_055168.2 | |
XM_011522448.1 | 667 | Missense Mutation | TAC,TTC | Y,F 165 | XP_011520750.1 | |
XM_011522450.2 | 667 | Missense Mutation | TAC,TTC | Y,F 49 | XP_011520752.1 |
SNHG19 - small nucleolar RNA host gene 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD60 - small nucleolar RNA, C/D box 60 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRAF7 - TNF receptor associated factor 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |