Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGGGAAGGAGGCCGAGAGGAGACC[A/G]AGCGTGAGGGGTCCGGGGGCGAGGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600999 MIM: 605088 MIM: 612033 MIM: 614386 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MAZ PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MAZ - MYC associated zinc finger protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MVP - major vault protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAGR1 - PAXIP1 associated glutamate rich protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024516.3 | 491 | Missense Mutation | AAG,GAG | K,E 58 | NP_078792.1 |
PRRT2 - proline rich transmembrane protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256442.1 | 491 | Intron | NP_001243371.1 | |||
NM_001256443.1 | 491 | Intron | NP_001243372.1 | |||
NM_145239.2 | 491 | Intron | NP_660282.2 | |||
XM_011545715.2 | 491 | Intron | XP_011544017.1 | |||
XM_011545716.2 | 491 | Intron | XP_011544018.1 | |||
XM_017022887.1 | 491 | Intron | XP_016878376.1 | |||
XM_017022888.1 | 491 | Intron | XP_016878377.1 | |||
XM_017022889.1 | 491 | Intron | XP_016878378.1 |