Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGCAGCGTCCCCTGCTATCCCCC[A/G]CCTGCCCCAGGGGAGTTCCCTGAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603267 MIM: 605754 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CAPN15 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CAPN15 - calpain 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107987233 - uncharacterized LOC107987233 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NHLRC4 - NHL repeat containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIGQ - phosphatidylinositol glycan anchor biosynthesis class Q | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRR35 - proline rich 35 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145270.2 | 855 | Silent Mutation | CCA,CCG | P,P 192 | NP_660313.1 | |
XM_017022959.1 | 855 | Silent Mutation | CCA,CCG | P,P 192 | XP_016878448.1 | |
XM_017022960.1 | 855 | Silent Mutation | CCA,CCG | P,P 192 | XP_016878449.1 | |
XM_017022961.1 | 855 | Intron | XP_016878450.1 |