Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAACTGCTGCCTGTACACCTCGTG[C/T]GAGCGTTCGCTCAGGCTCCTCACGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 182880 MIM: 182890 MIM: 190232 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PRM1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PRM1 - protamine 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRM2 - protamine 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286356.1 | 149 | Silent Mutation | TCA,TCG | S,S 13 | NP_001273285.1 | |
NM_001286357.1 | 149 | Silent Mutation | TCA,TCG | S,S 13 | NP_001273286.1 | |
NM_001286358.1 | 149 | Silent Mutation | TCA,TCG | S,S 13 | NP_001273287.1 | |
NM_001286359.1 | 149 | Silent Mutation | TCA,TCG | S,S 13 | NP_001273288.1 | |
NM_002762.3 | 149 | Silent Mutation | TCA,TCG | S,S 13 | NP_002753.2 |
PRM3 - protamine 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNP2 - transition protein 2 (during histone to protamine replacement) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |