Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTCGTGGGCTTCTGCTTCCTCACC[A/C]ATCAGTGGCAGCGCACGGCGCCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600924 MIM: 611256 MIM: 603927 | ||||||||||||||||||||
Literature Links: |
GFER PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GFER - growth factor, augmenter of liver regeneration | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOXO1 - NADPH oxidase organizer 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYNGR3 - synaptogyrin 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004209.5 | 540 | Missense Mutation | AAT,CAT | N,H 128 | NP_004200.2 |
ZNF598 - zinc finger protein 598 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |