Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCGCCGCGGCACTTGTGCGGCTGG[G/T]TAATGAGCAGTGGAAACCGCCGCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609077 MIM: 603500 | ||||||||||||||||||||
Literature Links: |
B3GNT9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
B3GNT9 - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033309.2 | 623 | Missense Mutation | AAC,ACC | N,T 101 | NP_171608.2 |
C16orf70 - chromosome 16 open reading frame 70 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FBXL8 - F-box and leucine rich repeat protein 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRADD - TNFRSF1A associated via death domain | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |