Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTTGTGGGGCAGTGGCCATGGAG[C/G]CTACGGGGCAGCCTACGGGGCAGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605178 MIM: 605179 | ||||||||||||||||||||
Literature Links: |
DBNDD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DBNDD1 - dysbindin domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GAS8 - growth arrest specific 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286205.1 | Intron | NP_001273134.1 | ||||
NM_001286208.1 | Intron | NP_001273137.1 | ||||
NM_001286209.1 | Intron | NP_001273138.1 | ||||
NM_001481.2 | Intron | NP_001472.1 | ||||
XM_005256304.4 | Intron | XP_005256361.1 | ||||
XM_005256309.4 | Intron | XP_005256366.1 | ||||
XM_006721175.3 | Intron | XP_006721238.1 | ||||
XM_011522990.2 | Intron | XP_011521292.1 | ||||
XM_011522991.1 | Intron | XP_011521293.1 | ||||
XM_011522992.2 | Intron | XP_011521294.1 | ||||
XM_017023122.1 | Intron | XP_016878611.1 | ||||
XM_017023123.1 | Intron | XP_016878612.1 | ||||
XM_017023124.1 | Intron | XP_016878613.1 | ||||
XM_017023125.1 | Intron | XP_016878614.1 |
GAS8-AS1 - GAS8 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |