Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGAACAAAGTTCTGGACGTGGATG[G/T]TGTGAAGGTGAAGCTGCAGGTAAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605455 MIM: 606692 | ||||||||||||||||||||
Literature Links: |
RAB26 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
RAB26 - RAB26, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308053.1 | 502 | Missense Mutation | GGT,GTT | G,V 44 | NP_001294982.1 | |
NM_014353.4 | 502 | Missense Mutation | GGT,GTT | G,V 110 | NP_055168.2 | |
XM_011522448.1 | 502 | Missense Mutation | GGT,GTT | G,V 110 | XP_011520750.1 | |
XM_011522450.2 | 502 | UTR 5 | XP_011520752.1 |
SNHG19 - small nucleolar RNA host gene 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD60 - small nucleolar RNA, C/D box 60 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRAF7 - TNF receptor associated factor 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |