Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTGTATATCCTGAACTGTCAGTC[G/A]ACCTAGCTGAACTCCAGCCAGCCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601025 MIM: 601758 | ||||||||||||||||||||
Literature Links: |
AP2B1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AP2B1 - adaptor related protein complex 2 beta 1 subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105371743 - uncharacterized LOC105371743 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PEX12 - peroxisomal biogenesis factor 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000286.2 | 1220 | Nonsense Mutation | CGA,TGA | R,* 202 | NP_000277.1 |
SNORD7 - small nucleolar RNA, C/D box 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |