Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGAGAGTCTTCTGAGGGTTTAGTG[C/T]GTTCCAGGGGTGGCCTCTGGCGGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605339 MIM: 604041 MIM: 601297 | ||||||||||||||||||||
Literature Links: |
FXR2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FXR2 - FMR1 autosomal homolog 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004860.3 | 2254 | Missense Mutation | CAC,CGC | H,R 630 | NP_004851.2 |
LOC100996842 - uncharacterized LOC100996842 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MPDU1 - mannose-P-dolichol utilization defect 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SOX15 - SRY-box 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |