Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGCTGGATGGGGATGCGGCCTGTC[C/T]TCTTGGGGTCGATGAGCCCCCCGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 123828 MIM: 601590 MIM: 613130 | ||||||||||||||||||||
Literature Links: |
CDK3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDK3 - cyclin dependent kinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EVPL - envoplakin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320747.1 | 6166 | Missense Mutation | AAG,AGG | K,R 1971 | NP_001307676.1 | |
NM_001988.3 | 6166 | Missense Mutation | AAG,AGG | K,R 1949 | NP_001979.2 |
TEN1 - TEN1 CST complex subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TEN1-CDK3 - TEN1-CDK3 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |